Minor changes.

5 files changed, 139 insertions, 137 deletions

diff --git a/SequenceViewer/app/routes.py b/SequenceViewer/app/routes.py
index 2ee9c46..9e9bad7 100644
--- a/SequenceViewer/app/routes.py
+++ b/SequenceViewer/app/routes.py
@@ -3,7 +3,7 @@ from Bio import SeqIO
 from GenoFusion.Utils import get_sequence_properties
 import os
 from app import app
-from .sequence_tools import translate_sequence, find_enzyme_sites
+from .sequence_tools import translate_sequence, find_enzyme_sites, get_color_for_enzyme, enzyme_groups
 
 @app.route('/')
 def index():
@@ -29,66 +29,51 @@ def view_file(filename):
     sequences = []
 
     with open(filepath, "r") as handle:
-        if file_type in ['fasta', 'fa']:
-            for record in SeqIO.parse(handle, "fasta"):
-                sequence_str = str(record.seq)
-                highlighted_sequence, enzyme_sites = find_enzyme_sites(sequence_str, selected_group='All Commercial')
-                sequence_properties = get_sequence_properties(sequence_str)
-                amino_acid_sequence = translate_sequence(sequence_str)
-                sequences.append({
-                    "id": record.id,
-                    "sequence": sequence_str,
-                    "highlighted_sequence": highlighted_sequence,
-                    "amino_acid_sequence": amino_acid_sequence,
-                    "features": enzyme_sites,
-                    "properties": sequence_properties
-                })
-        elif file_type in ['fastq']:
-            for record in SeqIO.parse(handle, "fastq"):
-                sequence_str = str(record.seq)
-                highlighted_sequence, enzyme_sites = find_enzyme_sites(sequence_str, selected_group='All Commercial')
-                sequence_properties = get_sequence_properties(sequence_str)
-                amino_acid_sequence = translate_sequence(sequence_str)
-                sequences.append({
-                    "id": record.id,
-                    "highlighted_sequence": highlighted_sequence,
-                    "amino_acid_sequence": amino_acid_sequence,
-                    "features": enzyme_sites,
-                    "properties": sequence_properties
-                })
-        elif file_type in ['gb', 'genbank']:
-            for record in SeqIO.parse(handle, "genbank"):
-                sequence_str = str(record.seq)
-                highlighted_sequence, enzyme_sites = find_enzyme_sites(sequence_str, selected_group='All Commercial')
-                features = [f"{feature.type}: {feature.location}" for feature in record.features]
-                features.extend([f"{enzyme} site at {start}-{end}" for enzyme, start, end in enzyme_sites])
-                sequence_properties = get_sequence_properties(sequence_str)
-                amino_acid_sequence = translate_sequence(sequence_str)
-                sequences.append({
-                    "id": record.id,
-                    "highlighted_sequence": highlighted_sequence,
-                    "amino_acid_sequence": amino_acid_sequence,
-                    "features": features,
-                    "properties": sequence_properties
-                })
+        for record in SeqIO.parse(handle, file_type):
+            sequence_str = str(record.seq)
+            highlighted_sequence, enzyme_sites = find_enzyme_sites(sequence_str, selected_group='All Commercial')
+            sequence_properties = get_sequence_properties(sequence_str)
+            amino_acid_sequence = translate_sequence(sequence_str)
+            sequences.append({
+                "id": record.id,
+                "sequence": sequence_str,
+                "highlighted_sequence": highlighted_sequence,
+                "amino_acid_sequence": amino_acid_sequence,
+                "features": enzyme_sites,
+                "properties": sequence_properties
+            })
 
-    selected_enzyme_type = request.args.get('enzyme_type', 'All Commercial')
+    selected_enzyme_type = request.args.get('enzyme_type', '6+ Cutters')
     filtered_sequences = []
 
     for sequence in sequences:
         filtered_features = []
-        for feature in sequence['features']:
-            if selected_enzyme_type == 'All Commercial' or selected_enzyme_type in feature[0]:
-                filtered_features.append(feature)
+        enzyme_objects = []
+        for enzyme_info in sequence['features']:
+            enzyme = enzyme_info[0]
+            start = enzyme_info[1]
+            end = enzyme_info[2]
+            color = get_color_for_enzyme(enzyme.__name__)
+            if selected_enzyme_type == 'Fermentas' or selected_enzyme_type in enzyme_groups or selected_enzyme_type in enzyme.__class__.__name__:
+                filtered_features.append((enzyme, start, end, color))
+                enzyme_objects.append({
+                    "name": enzyme.__name__,
+                    "rseq": enzyme.site,
+                    "fcut": 0,
+                    "rcut": len(enzyme.site),
+                    "color": color
+                })
         sequence['features'] = filtered_features
+        sequence['enzyme_objects'] = enzyme_objects
         filtered_sequences.append(sequence)
 
     sequences_data = [{
         'id': sequence['id'],
         'description': '',
-        'sequence': sequence['highlighted_sequence'],
+        'sequence': sequence.get('sequence', ''),
         'amino_acid_sequence': sequence['amino_acid_sequence'],
-        'features': sequence['features']
+        'features': sequence['features'],
+        'enzyme_objects': sequence['enzyme_objects']
     } for sequence in filtered_sequences]
 
-    return render_template('view.html', sequences=sequences_data, filename=filename)
\ No newline at end of file
+    return render_template('view.html', sequences=sequences_data, filename=filename)
diff --git a/SequenceViewer/app/sequence_tools.py b/SequenceViewer/app/sequence_tools.py
index 6239f0b..5fb2db5 100644
--- a/SequenceViewer/app/sequence_tools.py
+++ b/SequenceViewer/app/sequence_tools.py
@@ -1,22 +1,29 @@
+import random
 from Bio.Seq import Seq
-from Bio.Restriction import AllEnzymes, CommOnly, RestrictionBatch
+from Bio.Restriction import AllEnzymes, CommOnly
 
-# Manually define enzymes for groups that cannot be filtered programmatically
-NEB_enzymes = ['EcoRI', 'BamHI', 'HindIII']  # Example list, expand as needed
-Fermentas_enzymes = ['BglII', 'EcoRV', 'HindIII']  # Example list, expand as needed
+# Define groups of enzymes
+NEB_enzymes = ['EcoRI', 'BamHI', 'HindIII']
+Fermentas_enzymes = ['BglII', 'EcoRV', 'HindIII']
 
+# Functions to categorize enzymes
 def is_unique(enzyme):
+    """Check if an enzyme recognizes a unique sequence in a 10kb sequence of 'A's."""
     return len(enzyme.search(Seq("A" * 10000))) == 1
 
 def is_double_cutter(enzyme):
+    """Check if an enzyme recognizes exactly two sites in a 10kb sequence of 'A's."""
     return len(enzyme.search(Seq("A" * 10000))) == 2
 
 def is_type_iis(enzyme):
+    """Check if an enzyme is a Type IIS enzyme."""
     return enzyme.elucidate().startswith("^") or enzyme.elucidate().endswith("^")
 
 def is_nicking(enzyme):
+    """Check if an enzyme is a nicking endonuclease."""
     return "Nicking" in enzyme.__class__.__name__
- 
+
+# Group enzymes based on properties
 enzyme_groups = {
     "All Commercial": CommOnly,
     "Nonredundant Commercial": CommOnly,  # This should be updated with a proper list if available
@@ -31,7 +38,22 @@ enzyme_groups = {
     "Nicking Endonucleases": [enzyme for enzyme in AllEnzymes if is_nicking(enzyme)]
 }
 
+# Define colors for enzyme highlighting
+colors = [
+    "red", "green", "blue", "yellow", "orange", "purple", "cyan", "magenta", "lime", "pink",
+    "teal", "lavender", "brown", "beige", "maroon", "mint", "olive", "coral", "navy", "grey"
+]
+
+enzyme_colors = {}
+
+def get_color_for_enzyme(enzyme_name):
+    """Assign a random color to each enzyme for highlighting."""
+    if enzyme_name not in enzyme_colors:
+        enzyme_colors[enzyme_name] = random.choice(colors)
+    return enzyme_colors[enzyme_name]
+
 def get_enzyme_sites(sequence, enzymes):
+    """Find enzyme recognition sites in a given DNA sequence."""
     enzyme_sites = []
     for enzyme in enzymes:
         for site in enzyme.search(sequence):
@@ -40,35 +62,51 @@ def get_enzyme_sites(sequence, enzymes):
     return enzyme_sites
 
 def translate_sequence(nucleotide_sequence):
+    """Translate a nucleotide sequence into a protein sequence."""
     sequence = Seq(nucleotide_sequence)
     return str(sequence.translate())
 
 def find_enzyme_sites(sequence_str, selected_group):
+    """Highlight enzyme recognition sites in a DNA sequence."""
     if selected_group in enzyme_groups:
         enzymes = enzyme_groups[selected_group]
     else:
-        enzymes = AllEnzymes  # Fallback to AllEnzymes if group not found
-
-    restriction_batch = RestrictionBatch(enzymes)
-
-    enzyme_sites = []
-    for enzyme in restriction_batch:
-        seq_obj = Seq(sequence_str)
- 
-        sites = enzyme.search(seq_obj)
-        for site in sites:
-            enzyme_sites.append((enzyme, site, site + len(enzyme.site)))
-
-    enzyme_sites.sort(key=lambda x: x[1])
+        enzymes = AllEnzymes  # Default to all enzymes if group not found
 
+    enzyme_sites = get_enzyme_sites(Seq(sequence_str), enzymes)
     highlighted_sequence = ""
     last_end = 0
 
     for enzyme, start, end in enzyme_sites:
         highlighted_sequence += sequence_str[last_end:start]
-        highlighted_sequence += f'<span class="enzyme" data-enzyme="{enzyme}">{sequence_str[start:end]}</span>'
+        highlighted_sequence += f'<span class="enzyme" data-enzyme="{enzyme}" style="background-color:{get_color_for_enzyme(enzyme.__name__)}">{sequence_str[start:end]}</span>'
         last_end = end
 
     highlighted_sequence += sequence_str[last_end:]
 
-    return highlighted_sequence, enzyme_sites
\ No newline at end of file
+    return highlighted_sequence, enzyme_sites
+
+def get_sequence_properties(sequence_str):
+    """Calculate basic properties of a DNA sequence."""
+    sequence = Seq(sequence_str)
+    gc_content = (sequence.count("G") + sequence.count("C")) / len(sequence) * 100
+    return {
+        "length": len(sequence),
+        "gc_content": gc_content
+    }
+
+# Example usage:
+sequence = "ATGCGTACG"
+selected_group = "Fermentas"
+
+highlighted_sequence, enzyme_sites = find_enzyme_sites(sequence, selected_group)
+sequence_properties = get_sequence_properties(sequence)
+
+print("Highlighted Sequence:")
+print(highlighted_sequence)
+print("\nEnzyme Sites:")
+for enzyme, start, end in enzyme_sites:
+    print(f"{enzyme.__name__} cuts at position {start}-{end}")
+
+print("\nSequence Properties:")
+print(sequence_properties)
diff --git a/SequenceViewer/app/static/genview.css b/SequenceViewer/app/static/genview.css
index ea31ff1..5c73952 100644
--- a/SequenceViewer/app/static/genview.css
+++ b/SequenceViewer/app/static/genview.css
@@ -193,15 +193,7 @@ hr {
     margin: 0 auto; 
     padding: 0 15px;
     box-sizing: border-box;
-}
-
-.view {
-    display: flex;
-    flex-direction: column;
-    align-items: center;
-    justify-content: center;
-    height: 100vh; /* Optional: This will make the container take up the full height of the viewport */
-}
+} 
 
 .enzyme {
     background-color: transparent;
diff --git a/SequenceViewer/app/templates/view.html b/SequenceViewer/app/templates/view.html
index ea1f638..6173d55 100644
--- a/SequenceViewer/app/templates/view.html
+++ b/SequenceViewer/app/templates/view.html
@@ -5,68 +5,57 @@
     <meta name="viewport" content="width=device-width, initial-scale=1.0">
     <title>View Sequences - {{ filename }}</title>
     <link rel="stylesheet" href="{{ url_for('static', filename='genview.css') }}">
+    <script src="https://unpkg.com/seqviz"></script>
+    <style>
+        .enzyme {
+            color: black;
+            border: 1px solid red;
+            padding: 2px;
+        }
+    </style>
 </head>
 <body>
-    <div class="container view">
+    <div class="container">
         <h1>Viewing Sequences from {{ filename }}</h1>
         <a href="{{ url_for('index') }}">View Another File</a>
         <hr>
-        <div>
-            <button onclick="filterEnzymes('All Commercial')">All Commercial</button>
+        {% for record in sequences %}
+        <div class="sequence-container">
+            <div style="overflow: hidden;" id="seqviz-{{ record.id }}"></div>
+            <script>
+                window.seqviz.Viewer("seqviz-{{ record.id }}", {
+                    name: "{{ record.id }}",
+                    seq: "{{ record.sequence|safe }}",
+                    style: { height: "65vh", width: "65vw", color: "white" },
+                    bpColors: { A: "white", T: "white", G: "white", C: "white" },
+                    highlights: [
+                        {% for enzyme, start, end, color in record.features %}
+                        { start: {{ start }}, end: {{ end }}, color: "{{ color }}" },
+                        {% endfor %}
+                    ],
+                    enzymes: [
+                        {% for enzyme in record.enzyme_objects %}
+                        {
+                            name: "{{ enzyme.name }}",
+                            rseq: "{{ enzyme.rseq }}",
+                            fcut: {{ enzyme.fcut }},
+                            rcut: {{ enzyme.rcut }},
+                            color: "{{ enzyme.color }}"
+                        },
+                        {% endfor %}
+                    ],
+                    viewer: "both_flip"
+                }).render();
+            </script>
+            <hr>
         </div>
-        <hr>
-        <ul>
-            {% for record in sequences %}
-            <li id="{{ record.id }}">
-                <strong>ID: {{ record.id }}</strong><br>
-                <pre>{{ record.sequence|safe }}</pre>
-                <h3>Amino Acid Sequence</h3>
-                <pre>{{ record.amino_acid_sequence }}</pre>
-                <div class="details" id="details-{{ record.id }}">
-                    <h3>Features</h3>
-                    <button class="close-details">Close</button>
-                    <ul>
-                    {% for feature in record.features %}
-                        <li>
-                            <a href="#{{ record.id }}">
-                                {{ feature[0] }} at position {{ feature[1] }}-{{ feature[2] }}
-                            </a>
-                        </li>
-                    {% endfor %}
-                    </ul>
-                </div>
-            </li>
         {% endfor %}
     </div>
-    <script>
-        document.querySelectorAll('.enzyme').forEach(function(el) {
-            el.addEventListener('click', function() {
-                const id = this.closest('li').id;
-                const details = document.getElementById('details-' + id);
-                if (details.style.display === 'none' || details.style.display === '') {
-                    details.style.display = 'block';
-                } else {
-                    details.style.display = 'none';
-                }
-            });
-        });
-
-        document.querySelectorAll('.close-details').forEach(function(el) {
-            el.addEventListener('click', function() {
-                this.parentElement.style.display = 'none';
-            });
-        });
-
-        function highlightFeature(id, start, end) {
-            const sequence = document.querySelector('#' + id + ' pre');
-            const text = sequence.textContent;
-            const before = text.slice(0, start);
-            const feature = text.slice(start, end);
-            const after = text.slice(end);
-
-            sequence.innerHTML = `${before}<span class="highlight">${feature}</span>${after}`;
-            window.location.hash = id;
-        }
-    </script>
+    <footer>
+        <center>
+            <img src="{{ url_for('static', filename='img/LFX-genofusionv.png') }}" alt="Logo" width="100px">
+            <p>2024 &copy; Linear Fox, Sequences Viewer (open source under Apache License)</p>
+        </center>
+    </footer>
 </body>
 </html>
diff --git a/SequenceViewer/example.fasta b/SequenceViewer/example.fasta
index c01aa78..3c76530 100644
--- a/SequenceViewer/example.fasta
+++ b/SequenceViewer/example.fasta
@@ -1,4 +1,2 @@
 >Sequence_1
-GGATCCGCGGCCGCAAGCTTGAATTCCGCGGCCGCAAGCTTGAATTCCGCGGCCGCAAGCTTGAATTCCGCGGCCGCAAGCTTGAATTC
->Sequence_2
-AGCTTGCGGCCGCGGATCCAGCTTGAATTCGCGGCCGCGGATCCAGCTTGAATTCGCGGCCGCGGATCCAGCTTGAATTCGCGGCCGC
\ No newline at end of file
+CGCATAGTGAGAGTTACATGTTCGTTGGGCTCTTCCGACACGAACCTCAG
\ No newline at end of file